Fusion of non-hemolytic, truncated form of listeriolysin O to antigens to enhance immunogenicity
An object of the present invention is to provide a method for enhancing the immunogenicity of an antigen which comprises fusing to the antigen a non-hemolytic truncated form of listeriolysin O (.DELTA... Read More
Inventors: Paterson, Yvonne;, Assignee: The Trustees of the University of Pennsylvania (Philadelphia, PA) |
Cationic oligopeptides having microbicidal activity
What is claimed is: 1. A method for inhibiting microbial growth in an environment susceptible to said microbial growth, said method comprising: administering to said environment a microbial growth inh... Read More
Inventors: Lehrer, Robert I.; Selsted, Michael E.;, Assignee: The Regents of the University of California (Berkeley, CA) |
Antibiotic cryptdin peptides and methods of their use
The present invention provides substantially purified cryptdin peptides having a consensus amino acid sequence as follows: X.sub.1 -C-X.sub.2 -C-R-X.sub.3 -C-X.sub.4 -E-X.sub.5 -G-X.sub.6 -C-X.sub.7 -... Read More
Inventors: Selsted, Michael E.; Ouellette, Andre J.; Miller, Samuel I.;, Assignee: The Regents of the University of California (Oakland, CA); The Shriner's Hospital for Crippled Children (Tampa, FL); The General Hospital Corporation (Boston, MA) |
Broad spectrum antimicrobial compounds and methods of use
The present invention provides indolicidin analogs, which are tryptophan-rich peptides that have substantially the same amino acid sequence as naturally occurring indolicidin, exhibit broad spectrum a... Read More
Inventors: Selsted, Michael E.;, Assignee: The Regents of the University of California (Oakland, CA) |
Protegrins
We claim: 1. A purified and isolated or recombinantly produced compound having the formula: ##STR9## or a pharmaceutically acceptable salt or an N-terminal acylated or C-terminal amidated or esterifie... Read More
Inventors: Lehrer, Robert I.; Harwig, Sylvia S. L.; Kokryakov, Vladimir N.;, Assignee: University of California (Los Angeles, CA) |
Antibiotic cryptdin peptides and methods of their use
The present invention provides a substantially purified cryptdin peptide having a consensus amino acid sequence: X.sub.1 -C-X.sub.2 -C-R-X.sub.3 -C-X.sub.4 -E-X.sub.5 -C-X.sub.6 -C-C-X.sub.7 wherein X... Read More
Inventors: Selsted, Michael E.; Ouellette, Andre J.;, Assignee: The Regents of the University of California (Alameda, CA) |
Cyclic peptides having broad spectrum antimicrobial activity
OF THE INVENTION 5.1 Definitions "Peptidomimetic Moiety:" As used herein, "peptidomimetic moiety" refers to an organic molecule that mimics the secondary structure of a polypeptide chain. "Primary St... Read More
Inventors: Chang, Conway; Gu, Leo; Chen, Jie;, Assignee: IntraBiotics Pharmaceuticals, Inc. (Mountain View, CA) |
Vaccine for cytomegalovirus
What is claimed is: 1. A method for vaccinating a susceptible host to confer humoral immunity to human cytomegalovirus (hCMV), said method comprising inoculating the host with a polypeptide having imm... Read More
Inventors: Pereira, Lenore;, Assignee: Institut Merieux (Charbonnieres, FR) |
Compositions and methods for the detection, quantitation and purification of antigen-specific T cells
Methods and compositions are provided for labeling T cells according to the specificity of their antigen receptor. A stable multimeric complex is prepared with major histocompatibility complex protein... Read More
Inventors: Altman, John D.; McHeyzer-Williams, Michael G.; Davis, Mark M.;, Assignee: The Board of Trustees of the Leland Stanford Junior University (Stanford, CA) |
Immuno-reactive peptide CTL epitopes of human cytomegalovirus
OF THE PREFERRED EMBODIMENTS According to one aspect of the present invention, a nonapeptide (9 amino acid peptide) of the sequence NLVPMVATV (pp65.sub.495-503) (SEQ ID NO:1) is an immunogenic epitop... Read More
Inventors: Diamond, Don Jeffrey; York, Joanne;, Assignee: |
CTL epitope analogs
Accordingly, this invention comprises a method of producing a human cytomegalovirus peptide cytotoxic T lymphocyte epitope analog with improved immunogenic potency and retained breadth of recognition ... Read More
Inventors: Diamond, Don J.;, Assignee: City of Hope (Duarte, CA) |
HCMV-reactive T cells and uses therefor
OF THE PREFERRED EMBODIMENTS A nonapeptide having the sequence NLVPMVATV (pp65.sub.495-503) (SEQ ID NO:1) is an immunogenic epitope of pp65 from CMV laboratory strains AD169 and Towne and all wild ty... Read More
Inventors: Diamond, Don J.;, Assignee: City of Hope (Duarte, CA) |
Immuno-reactive peptide CTL epitopes of human cytomegalovirus
Accordingly, one aspect of the present invention relates to immunologically active peptides, and functional variants thereof, capable of eliciting a cellular immune response to HCMV in humans, e.g. SE... Read More
Inventors: Diamond, Don J.;, Assignee: City of Hope (Duarte, CA) |
Synthetic peptide having an ionophoric and antimicrobial activity
OF THE INVENTION Synthetic peptide P1 of the present invention is comprised by 26 amino acids. The natural existence of this peptide in bacteria and animals has not been reported in the literature. T... Read More
Inventors: Lemeshko, Viktor; Guzman, Fanny; Patarroyo, Manuel E.; Segura, Cesar; Orduz, Sergio;, Assignee: Corporacion Para Investigaciones Biologicas (Medellín, CO); Universidad de Antiqquia (Melellín, CO); Fundacion Instituto de Inmunologia de Columbia (Bogotá, CO); Universidad Nacional de Colombia (Bogotá, CO) |
Anti-TNF antibodies and peptides of human tumor necrosis factor
It is the object of the present invention to overcome one or more deficiencies of the background art. It is also an object of the present invention to provide methods having utility for in vitro, in s... Read More
Inventors: Le, Jumming; Vilcek, Jan; Daddona, Peter; Ghrayeb, John; Knight, David; Siegel, Scott;, Assignee: New York University (New York, NY); Centocor, Inc. (Malvern, PA) |
Rod-coil block polyimide copolymers
What is claimed is: 1. Rod-coil block copolymers having polyimide rod segments alternating with polyether coil segments derived from the reaction of approximately 20 to 50 parts by weight of a mixture... Read More
Inventors: Meador, Mary Ann B.; Kinder, James D.;, Assignee: The United States of America as represented by the Administrator of the (Washington, DC) |
System to detect protein-protein interactions
These and other objects are achieved by the present invention which provides a method and a kit for detecting interactions between proteins, in vivo, using reconstitution of the activity of a transcri... Read More
Inventors: Fields, Stanley; Song, Ok-Kyu;, Assignee: The Research Foundation of State University of New York (Albany, NY) |
Production of antibodies from transgenic animals
We claim: 1. A transgenic mouse which has had inserted into its genome DNA comprising human Vh, human Dh, human Jh segments and human mu segments of human immunoglobulins in germline configuration, su... Read More
Inventors: Surani, Azim M.; Neuberger, Michael S.; Bruggemann, Marianne;, Assignee: The Babraham Institute (Cambridge, GB); Medical Research Council (London, GB) |
Phosphoramidate and phosphorothioamidate oligomeric compounds
OF THE INVENTION Compounds of the invention are shown by Structure I above. In Structure I, the bracketed portion of Structure I, herein referred to as a repeating unit or monomeric unit, includes ei... Read More
Inventors: Cook, Phillip D.; Acevedo, Oscar; Hebert, Normand;, Assignee: ISIS Pharmaceuticals, Inc. (Carlsbad, CA) |
System to detect protein-protein interactions
These and other objects are achieved by the present invention which provides a method and a kit for detecting interactions between proteins, in vivo, using reconstitution of the activity of a transcri... Read More
Inventors: Fields, Stanley; Song, Ok-Kyu;, Assignee: The Research Foundation of State University of New York (Albany, NY) |
Methods for lymph node identification
The present invention describes materials and methods for the identification of sentinel lymph nodes by the surgeon and the pathologist and the presence or absence of lymph node metastases as an impor... Read More
Inventors: Morton, Donald L.;, Assignee: John Wayne Cancer Institute (Santa Monica, CA) |
Method for determining virulence of Yersinia
What is claimed is: 1. A method for determining virulence of a Yersinia strain, said method comprising: fragmenting the genome of a Yersinia strain with at least one restriction endonuclease to obtain... Read More
Inventors: Isberg, Ralph R.; Miller, Virginia; Falkow, Stanley;, Assignee: The Board of Trustees of the Leland Stanford Junior University (Stanford, CA) |
Compositions and methods for the oral delivery of active agents
What is claimed is: 1. A method for systemically delivering a protein or polypeptide drug to a mammalian host, said method comprising (a) orally administering to the host a composition which comprises... Read More
Inventors: Amkraut, Alfred A.; Yang, Heechung;, Assignee: Alza Corporation (Palo Alto, CA) |
Vaccine containing a Shigella bacterium having an enhanced antigenic property
This invention provides defined culture conditions and components incorporated into growth media of enteric bacteria to induce or enhance the presence of virulence factors and other antigens. Preferab... Read More
Inventors: Pace, John Lee; Walker, Richard Ives; Frey, Steven Michael;, Assignee: Antex Biologics Inc. (Gaithersburg, MD) |
Use of purified invaplex from gram negative bacteria as a vaccine
The present invention relates to a vaccine for gram-negative bacteria based on Invaplex and to methods for preparing such a vaccine. More particularly, the vaccine for gram-negative bacteria describe... Read More
Inventors: Oaks, Edwin V.; Turbyfill, Kevin Ross; Hartman, Antoinette Berrong;, Assignee: The United States of America as represented by the Secretary of the Army (Washington, DC) |
Method for producing a nematocidal composition by heat treating a pH-adjusted fermentation broth
OF THE INVENTION To produce a nematocidal preparation, a substantial amount of biomass is prepared by submerged fermentation of a bacterium or fungal microorganism. Preferred examples of microorganis... Read More
Inventors: Warrior, Prem; Heiman, Daniel Feulner; Rehberger, Linda Anne; Johnson, Ronald Eugene; Hansen, James Russell; McVicker, Kevin Allen;, Assignee: Valent BioSciences Corporation (Libertyville, IL) |
Viruses comprising mutant ion channel protein
OF THE INVENTION Definitions As used herein, the terms "isolated and/or purified" refer to in vitro preparation, isolation and/or purification of a vector, plasmid or virus of the invention, so that ... Read More
Inventors: Kawaoka, Yoshihiro;, Assignee: Wisconsin Alumni Research Foundation (Madison, WI) |
Steroid-activated nuclear receptors and uses therefor
OF THE INVENTION In accordance with the present invention, a new class of receptors has been identified that are part of the steroid/thyroid hormone superfamily of receptors, a representative member ... Read More
Inventors: Evans, Ronald M.; Blumberg, Bruce;, Assignee: The Salk Institute for Biological Studies (La Jolla, CA) |
Poly (5-aminoquinoxalines) and use thereof
What is claimed is: 1. A poly(5-aminoquinoxaline) having the general formula (1): ##STR35## in which R.sup.1 and R.sup.2 each independently represent a hydrogen atom, a hydroxyl group, a phenyl group,... Read More
Inventors: Nagasaki, Yukio; Furusho, Hitoshi; Chikama, Katsumi; Miyamoto, Hisae;, Assignee: Nissan Chemical Industries, Ltd. (Tokyo, JP) |
Nucleic acid molecules encoding SIGIRR polypeptides
OF THE INVENTION A cDNA encoding human SIGIRR polypeptide has been isolated and is disclosed in SEQ ID NO:1. ATGCCAGGTGTCTGTGATAGGGCCCCTGACTTCCTCTCCCCGTCTGAAGA CCAGGTGCTGAGGCCTGCCTTGGGCAGCTCAGTGGCTCT... Read More
Inventors: Sims, John Ernest;, Assignee: Immunex Corporation (Seattle, WA) |
Drugs 
